Sequence ID | >WENV170646517 |
Genome ID | JQGR01019580 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 52 |
End posion on genome | 138 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
agaattgcgt |
tRNA gene sequence |
GCCCTGGTGGTGGAATTGGTAGACACAAGGGATTTAAAATCCCTCGGCGTTCGCGCTGTG |
Downstream region at tRNA end position |
tctattaagt |
Secondary structure (Cloverleaf model) | >WENV170646517 Leu TAA t ACCA tctattaagt G - C C - G C - G C - G T + G G - C G - C T G T C G G C C A T A A G | | | | | A T G G T G G C C G G C G | | | T T G A C A C T A G A CGGCGTTCGCGCTGT A - T G - C G - C G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |