Sequence ID | >WENV170646518 |
Genome ID | JQGR01019596 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 100 |
End posion on genome | 184 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttaaatacct |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGAGCAGACTGTAAATCTGCCGGCTCCGCCTTCGAT |
Downstream region at tRNA end position |
tattgaaaac |
Secondary structure (Cloverleaf model) | >WENV170646518 Tyr GTA t ACCA tattgaaaac G - C G - C A - T G - C G - C G - C G - C T A T C T G C C A T G A T | | + | | G G G C C C G A T G G C G | | | T T C A G G G C A A A CGGCTCCGCCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |