Sequence ID | >WENV170648159 |
Genome ID | JRHI01000005 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 7845 |
End posion on genome | 7761 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
accttcttgt |
tRNA gene sequence |
GCGGAAGTGGCGGAACTGGCAGACGCACCATCTTGAGGGGGTGGCGCCGTAAGGCGTGGG |
Downstream region at tRNA end position |
accttttcat |
Secondary structure (Cloverleaf model) | >WENV170648159 Leu GAG t ACCA accttttcat G - C C - G G - C G - C A - T A - T G - C T A T C C C C C A C A A G | | | | | G T G G C G G G G G G C G | | | T T G A C G C C A G A CGCCGTAAGGCGT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |