Sequence ID | >WENV170648163 |
Genome ID | JRHI01000006 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 73598 |
End posion on genome | 73513 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgaggtgctg |
tRNA gene sequence |
GCCGGGGTGGCGGAATGGCATACGCGGACGCCTCAAAAGCGTCTGTCCCTAGGGGCATGC |
Downstream region at tRNA end position |
caaggatggc |
Secondary structure (Cloverleaf model) | >WENV170648163 Leu CAA g ACAA caaggatggc G - C C - G C - G G - C G - C G - C G + T T A T C G C C C A T A A G | | | | | G G G G C G G C G G G C G | | | T T C A C G C A T G TGTCCCTAGGGGCAT G - C A - T C - G G - C C - G C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |