Sequence ID | >WENV170648174 |
Genome ID | JRHI01000013 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 122426 |
End posion on genome | 122500 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atccttgatc |
tRNA gene sequence |
CGCGGCGTGGAGCAGTGGAAGCTCGTCGGGCTCATAACCCGAAGGTCGTTGGTTCGAATC |
Downstream region at tRNA end position |
cccctctcgc |
Secondary structure (Cloverleaf model) | >WENV170648174 Met CAT c ACCA cccctctcgc C A G - C C - G G - C G - C C - G G - C T A T C A A C C A G A G | | | | | G T C G A G G T T G G C G | | | | T T G G C T C A A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |