Sequence ID | >WENV170648187 |
Genome ID | JRHI01000023 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 66909 |
End posion on genome | 66998 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tgagccccaa |
tRNA gene sequence |
GGAGAGGTGCGAGAGCGGCCGAATCGGACTCACTGCTAATGAGTTGACTTGGGAAACCGG |
Downstream region at tRNA end position |
aaaatatcgc |
Secondary structure (Cloverleaf model) | >WENV170648187 Ser GCT a GCtc aaaatatcgc G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A C G A G | | | | | A G G A G C G A G G G C G | | | T T C A T C G C G A G TGACTTGGGAAACCGGGTCC A - T C - G T - A C - G A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |