Sequence ID | >WENV170648191 |
Genome ID | JRHI01000027 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 88116 |
End posion on genome | 88199 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
agtaaaaaga |
tRNA gene sequence |
GCCGAAGTGGTGAAATTGGTAGACACGCAACGTTCAGGGCGTTGTACTCGAAAGGGTGTG |
Downstream region at tRNA end position |
tccgtttttc |
Secondary structure (Cloverleaf model) | >WENV170648191 Leu CAG a Attt tccgtttttc G - C C - G C - G G - C A - T A - T G + T T G T C C C C C A T A A G | | | | | G T A G T G G G G G G C G | | | T T G A C A C T A G G TACTCGAAAGGGTGT C - G A - T A - T C - G G - C T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |