Sequence ID | >WENV170648214 |
Genome ID | JRHI01000054 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 30469 |
End posion on genome | 30383 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cggcaccttg |
tRNA gene sequence |
GCCGGGATGGCGGAATTGGTAGACGCGCTGGACTCAAAATCCAGTTCTGGCAACAGAGTG |
Downstream region at tRNA end position |
gcagttgatc |
Secondary structure (Cloverleaf model) | >WENV170648214 Leu CAA g ACCA gcagttgatc G + T C - G C - G G - C G - C G - C A - T T T T C C C C C A T A A G | | | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TTCTGGCAACAGAGT C - G T - A G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |