Sequence ID | >WENV170648216 |
Genome ID | JRHI01000058 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 105232 |
End posion on genome | 105143 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
acattggtcc |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTTGAATGCACCGCACTCGAAATGCGGCATACTCGCAAGGGTA |
Downstream region at tRNA end position |
gccgcctttg |
Secondary structure (Cloverleaf model) | >WENV170648216 Ser CGA c GCCA gccgcctttg G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T G A G | | | | | A G G A C G G T G G G C G | | | T T T A T G C T G A A CATACTCGCAAGGGTATC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |