Sequence ID | >WENV170648225 |
Genome ID | JRHI01000070 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 29904 |
End posion on genome | 29992 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
atgtcgcgct |
tRNA gene sequence |
GCCCGGGTGGTGAAACTGGTAGACACAGCGGACTTAAAATCCGCCGATGCCGAAACGCGT |
Downstream region at tRNA end position |
cattgaggcg |
Secondary structure (Cloverleaf model) | >WENV170648225 Leu TAA t ACtc cattgaggcg G - C C - G C - G C - G G + T G - C G - C T G T C G G C C A C A A G | | | | | G T A G T G G C C G G C G | | | T T G A C A C T A G A CGATGCCGAAACGCGTCGT G - C C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |