Sequence ID | >WENV170648230 |
Genome ID | JRHI01000077 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 68970 |
End posion on genome | 69058 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aagtacctgc |
tRNA gene sequence |
GCCTCGGTGGTGGAATTGGCAGACACGGCGGTTTCAAGAACCGCAGCTCCTTCGGAGCGC |
Downstream region at tRNA end position |
gatgaccacg |
Secondary structure (Cloverleaf model) | >WENV170648230 Leu CAA c ACCC gatgaccacg G - C C - G C - G T - A C - G G - C G + T T C T C T C C C A T A A G | | | | | A T G G T G G A G G G C G | | | T T G A C A C C A G G AGCTCCTTCGGAGCGCT G - C C - G G - C G - C T - A T A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |