Sequence ID | >WENV170648234 |
Genome ID | JRHI01000077 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 69578 |
End posion on genome | 69662 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
agtagtattg |
tRNA gene sequence |
GCACGGGTGGCGGAATTGGCAGACGCAGTGGATTTAGGTTCCACCGCCGAAAGGCGTAAG |
Downstream region at tRNA end position |
tggagaaatc |
Secondary structure (Cloverleaf model) | >WENV170648234 Leu TAG g ACCT tggagaaatc G - C C - G A - T C - G G - C G + T G - C T C T T T C C C A T A A G | | | | | A T G G C G A A G G G C G | | | T T G A C G C C A G A CGCCGAAAGGCGT G - C T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |