Sequence ID | >WENV170648249 |
Genome ID | JRHI01000077 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 77508 |
End posion on genome | 77434 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ttagtaatat |
tRNA gene sequence |
GCCGTAGTAGCTCAATGGTAGAGCACCTGTTTTGTAAACAGAAGGTTGCGGGTTCAACTC |
Downstream region at tRNA end position |
agtgtttgcg |
Secondary structure (Cloverleaf model) | >WENV170648249 Thr TGT t TCGA agtgtttgcg G - C C - G C - G G - C T - A A - T G - C T C T T A C C C A A A A + | | | A T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTT C A C - G T - A G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |