Sequence ID | >WENV170648252 |
Genome ID | JRHI01000077 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 76428 |
End posion on genome | 76355 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
catacggagt |
tRNA gene sequence |
GGCGAGGTAGCCAAGTGGCAAGGCAGCGGTCTGCAAAACCGCCATCGTGGGTTCGACTCC |
Downstream region at tRNA end position |
agcgctcgtg |
Secondary structure (Cloverleaf model) | >WENV170648252 Cys GCA t TCCA agcgctcgtg G - C G - C C - G G - C A C G - C G - C T C T T A C C C A G A A + | | | | G T A C C G G T G G G C G | | | T T G A G G C C A A CATC G - C C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |