Sequence ID | >WENV170648257 |
Genome ID | JRHI01000079 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 1450 |
End posion on genome | 1540 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttgccgacac |
tRNA gene sequence |
GGAGAGATGGCAGAGCGGTTGAATGCGGCGGTCTTGAAAACCGCTGAACGTGATGAGCGT |
Downstream region at tRNA end position |
cgcaccacat |
Secondary structure (Cloverleaf model) | >WENV170648257 Ser TGA c TCCA cgcaccacat G - C G - C A - T G - C A - T G - C A - T T A T C A C C C A C G A G | | | | | G G G A C G G T G G G C G | | | T T T A T G C T G A G TGAACGTGATGAGCGTTCC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |