Sequence ID | >WENV170648317 |
Genome ID | JRHI01000153 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 32714 |
End posion on genome | 32628 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttctgtgcca |
tRNA gene sequence |
GCCCCAGTGGCGGAACCGGTAGACGCGCCAGACTCAAAATCTGGTGTTCGCAAGGACGTG |
Downstream region at tRNA end position |
cgccgacaat |
Secondary structure (Cloverleaf model) | >WENV170648317 Leu CAA a ACCA cgccgacaat G - C C - G C - G C - G C - G A - T G - C T G T C G G G C A C A A G | | | | | G C G G C G G C C C G C G | | | T T G A C G C T A G G TGTTCGCAAGGACGT C - G C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |