Sequence ID | >WENV170648318 |
Genome ID | JRHI01000159 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 6014 |
End posion on genome | 6098 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tgatgtcgat |
tRNA gene sequence |
GCGGTCGTGGCGGAACTGGCAGACGCACTAGCTTGAGGTGCTAGCGCCGCAAGGCGTGGA |
Downstream region at tRNA end position |
cttattcctg |
Secondary structure (Cloverleaf model) | >WENV170648318 Leu GAG t ACCA cttattcctg G - C C - G G - C G - C T - A C - G G - C T G T T C T C C A C A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C C A G A CGCCGCAAGGCGT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |