Sequence ID | >WENV170648351 |
Genome ID | JRHI01000194 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 35364 |
End posion on genome | 35451 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gcgtgcactc |
tRNA gene sequence |
GGAAGCGTGGCAGAGCGGTCTAATGCACTCGCCTTGAAAGCGAGCGTACCGAGAGGTACC |
Downstream region at tRNA end position |
gcctgagcag |
Secondary structure (Cloverleaf model) | >WENV170648351 Ser TGA c GCCA gcctgagcag G - C G - C A - T A - T G - C C - G G - C T A T C T C C C A C G A G | + | | | G G G A C G G G G G G C G | | | T T T A T G C C T A A CGTACCGAGAGGTACC C - G T - A C - G G - C C - G C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |