Sequence ID | >WENV170648375 |
Genome ID | JRHI01000235 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 57074 |
End posion on genome | 57163 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cctccgcagc |
tRNA gene sequence |
GGAGGATTCGCCTAGTGGCCTATGGCGCACGATTGGAAATCGTGTTGGGTGTTAAAACCC |
Downstream region at tRNA end position |
ttgtgagcag |
Secondary structure (Cloverleaf model) | >WENV170648375 Ser GGA c GCCG ttgtgagcag G - C G - C A - T G - C G - C A - T T - A T A T C G C C C A T G A C | | | | | A G T C C G G C G G G C G | | | T T C T G G C C T A G TTGGGTGTTAAAACCCTC C - G A - T C - G G - C A - T T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |