Sequence ID | >WENV170648380 |
Genome ID | JRHI01000251 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 55837 |
End posion on genome | 55935 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
tacttcaggc |
tRNA gene sequence |
GGAGGCGAAAATAGTCCGGTGACTGTCGCGGCCTTCAAAGCCGCTGATTCGGTCCTTCGC |
Downstream region at tRNA end position |
tatgcattta |
Secondary structure (Cloverleaf model) | >WENV170648380 SeC TCA c GCCA tatgcattta G - C G - C A - T G - C G - C C - G G - C A A T C A C A C C C A C C T A | | | | | G G G A T A G T G G G C G | | + | T T T C T G T G A C TGATTCGGTCCTTCGCGGGTCGAATG G - C C - G G - C G - C C - G C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |