Sequence ID | >WENV170648386 |
Genome ID | JRHI01000267 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 35493 |
End posion on genome | 35406 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
agtattctaT |
tRNA gene sequence |
GGAGAGGTCGCATAGTGGCCTAGTGCGCTCGCCTGCTAAGTGAGTGGGGCGAATAGCTCC |
Downstream region at tRNA end position |
ccactaaatt |
Secondary structure (Cloverleaf model) | >WENV170648386 Ser GCT T GGtg ccactaaatt G - C G - C A - T G - C A - T G - C G - C T A T C T C T C A T G A C | | | | | G G T A C G G A G A G C G + | | | T T C G T G C C T A G TGGGGCGAATAGCTCCC C - G T - A C - G G + T C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |