Sequence ID | >WENV170648388 |
Genome ID | JRHI01000270 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 53388 |
End posion on genome | 53299 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtcgcatcac |
tRNA gene sequence |
GGAGAGGTGGATGAGCGGTTGAAGTCGCACGCCTGGAAAGCGTGTTTAGGTTAATTCCTA |
Downstream region at tRNA end position |
gtatatctat |
Secondary structure (Cloverleaf model) | >WENV170648388 Ser GGA c GCCA gtatatctat G - C G - C A - T G - C A - T G - C G - C T A T C G C C C A C G A G | | | | | G G G T A G G C G G G C G + | | T T T A G T C T G A G TTTAGGTTAATTCCTAAC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |