Sequence ID | >WENV170648428 |
Genome ID | JRHI01000375 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 19941 |
End posion on genome | 20024 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cttccgccag |
tRNA gene sequence |
GCCGGGGTGGCGGAACGGTAGACGCAGCGGTCTCAAAAACCGCCGGGGGCAACCCCGTGA |
Downstream region at tRNA end position |
tggattcgta |
Secondary structure (Cloverleaf model) | >WENV170648428 Leu CAA g ACgc tggattcgta G - C C - G C - G G - C G - C G - C G + T T C T C T C C C A C A A G | | | | | G G G G C G G A G G G C G | | | T T T A C G C A G A CGGGGGCAACCCCGT G - C C - G G - C G - C T - A C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |