Sequence ID | >WENV170648439 |
Genome ID | JRHI01000399 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 44353 |
End posion on genome | 44260 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tgtccagacc |
tRNA gene sequence |
GGAGACGTGGCCGAGTGGCTGAAGGCGGCGGTTTGCTAAACCGTTATACGCTTGTAAAGG |
Downstream region at tRNA end position |
atccagattt |
Secondary structure (Cloverleaf model) | >WENV170648439 Ser GCT c GCCA atccagattt G - C G - C A - T G - C A - T C - G G - C T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C T G A G TATACGCTTGTAAAGGCGTATC G + T C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |