Sequence ID | >WENV170648452 |
Genome ID | JRHI01000420 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 2495 |
End posion on genome | 2409 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
aaaacacagt |
tRNA gene sequence |
GCCCAAGTGGCGGAATTGGCAGACGCGCTAGATTCAGGGTCTAGTGGCCGCAAGGTCGTG |
Downstream region at tRNA end position |
tagtttccaa |
Secondary structure (Cloverleaf model) | >WENV170648452 Leu CAG t ACCA tagtttccaa G - C C - G C - G C - G A - T A - T G - C T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C C A G G TGGCCGCAAGGTCGT C - G T - A A - T G - C A - T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |