Sequence ID | >WENV170648475 |
Genome ID | JRHI01000496 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 21161 |
End posion on genome | 21077 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
aacttccaca |
tRNA gene sequence |
GCCCTGGTGGCGGAATTGGTAGACGCGCTGGTTTCAGGTACCAGTGGCTGCAAGGCTATA |
Downstream region at tRNA end position |
tttgctgcat |
Secondary structure (Cloverleaf model) | >WENV170648475 Leu CAG a ACtt tttgctgcat G - C C - G C - G C - G T - A G - C G - C T G T T T C C C A T A A G | + | | | G T G G C G A G G G G C G | | | T T G A C G C T A G G TGGCTGCAAGGCTAT C - G T - A G - C G - C T - A T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |