Sequence ID | >WENV170648495 |
Genome ID | JRHI01000576 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 37540 |
End posion on genome | 37451 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tgggccgcaC |
tRNA gene sequence |
GGAGAGGTGGTCGAGTGGTTAAAGGCACCCGCCTCGAAAGCGGGCAGACGTGATGAGCGT |
Downstream region at tRNA end position |
tccatatacg |
Secondary structure (Cloverleaf model) | >WENV170648495 Ser CGA C GTtg tccatatacg G - C G - C A - T G - C A - T G - C G - C T A T C T C T C A T G A G | | | | | G G G C T G G A G A G C G | + | T T T A G G C T A A A CAGACGTGATGAGCGTCTC C - G C - G C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |