Sequence ID | >WENV170648515 |
Genome ID | JRHI01000652 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 23004 |
End posion on genome | 23085 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
acaggcgagc |
tRNA gene sequence |
GGCCGAGTGATGGAATGGCAGACATGCGGCACTCAAAATGCCGTGCCCTTCGGGCGTGTG |
Downstream region at tRNA end position |
cgcctgtctt |
Secondary structure (Cloverleaf model) | >WENV170648515 Leu CAA c Aatt cgcctgtctt G - C G - C C - G C - G G - C A - T G - C T G T C A C C C A T A A G | | | | | G G G G T A G T G G G C G | | | T T C A C A T A G G TGCCCTTCGGGCGT C - G G - C G - C C - G A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |