Sequence ID | >WENV170648517 |
Genome ID | JRHI01000658 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 16455 |
End posion on genome | 16364 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tggcacaccc |
tRNA gene sequence |
GGGGAGGTCGCATAGTCCGGTCGAGTGCGCCGCGGTGCTAACGCGGTGAGTCTGAAAGGG |
Downstream region at tRNA end position |
ggcgttgccg |
Secondary structure (Cloverleaf model) | >WENV170648517 Ser GCT c GCAA ggcgttgccg G - C G - C G - C G - C A - T G - C G - C T A T C G C C C A C T G A C | | | | | G C T A C G G C G G G C G + | | | T T G G T G C T C G A G TGAGTCTGAAAGGGCTCC C - G C - G G - C C - G G - C G A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |