Sequence ID | >WENV170648565 |
Genome ID | JRHI01000814 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 10856 |
End posion on genome | 10763 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
ctcgtgcctt |
tRNA gene sequence |
GGGAGAAGTCTGGGGCTGGTGCCTCAGCCGGTCTTCAAAACCGCGTTGGTCTCCGCAAGG |
Downstream region at tRNA end position |
taacttttag |
Secondary structure (Cloverleaf model) | >WENV170648565 SeC(p) TCA t GCCc taacttttag G - C G - C G - C A - T G - C A - T A - T G - C T T T T A T C C A T C G C + | | | | G G G G G T G T A G G C G | + | | T T T C T C A G C G GTTGGTCTCCGCAAGGGGACTG C C C - G G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |