Sequence ID | >WENV170648567 |
Genome ID | JRHI01000822 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 23029 |
End posion on genome | 22940 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
agcgcctcgc |
tRNA gene sequence |
GGAGGGGTGGCCGAGTGGCTGAAGGCGCACGCTTGGAAAGCGTGTGGGCGGGAAACCGTC |
Downstream region at tRNA end position |
gtgaccttcc |
Secondary structure (Cloverleaf model) | >WENV170648567 Ser GGA c GCCA gtgaccttcc G - C G - C A - T G - C G - C G - C G - C T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T C A G G C T G A G TGGGCGGGAAACCGTCTC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |