Sequence ID | >WENV170648598 |
Genome ID | JRHI01001023 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 12926 |
End posion on genome | 13009 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
agaagcggta |
tRNA gene sequence |
GGGCAGATGGCCGAGCGGCCAATGGCACCAGACTGTAAATCTGGCGGGTTATCCCTACGC |
Downstream region at tRNA end position |
ccttcgccga |
Secondary structure (Cloverleaf model) | >WENV170648598 Tyr GTA a ACtg ccttcgccga G - C G - C G - C C - G A - T G - C A - T T A T C G T C C A C G A G | | | | | G G G C C G G C A G G C G + | | | T T C T G G C C A A A CGGGTTATCCCTAC C - G C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |