Sequence ID | >WENV170648626 |
Genome ID | JRHI01001109 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 7657 |
End posion on genome | 7742 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gtggccgaaa |
tRNA gene sequence |
AGCCGCGTGGTGGAATGGCAGACACAAGGGACTTAAAATCCCTTGGGGGGTGACCCCCGT |
Downstream region at tRNA end position |
aatcaccctg |
Secondary structure (Cloverleaf model) | >WENV170648626 Leu TAA a ACtg aatcaccctg A - T G - C C - G C - G G - C C - G G - C T G T C G C C C A T A A G | | | | | A G G G T G G C G G G C G | | | T T C A C A C A G A TGGGGGGTGACCCCCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |