Sequence ID | >WENV170648643 |
Genome ID | JRHI01001233 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 18514 |
End posion on genome | 18599 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tcgatggggg |
tRNA gene sequence |
GCCCCAGTGGTGGAACGGTAGACGCGCTGGACTCAAAATCCAGTGTCCGCAAGGACGTGG |
Downstream region at tRNA end position |
attcgatttt |
Secondary structure (Cloverleaf model) | >WENV170648643 Leu CAA g ACCA attcgatttt G - C C - G C - G C - G C - G A - T G - C T G T C T C C C A C A A G | + | | | A G G G T G G G G G G C G | + | T T T A C G C A G G TGTCCGCAAGGACGT C - G T - A G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |