Sequence ID | >WENV170648652 |
Genome ID | JRHI01001262 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 5193 |
End posion on genome | 5285 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
atgcgtcgcT |
tRNA gene sequence |
GGAAGGGTCGCATAGCTGGCCTAGTGCGCGCGACTGGAAATCGCGTAGGCGGTTACACCG |
Downstream region at tRNA end position |
cctgatcgtt |
Secondary structure (Cloverleaf model) | >WENV170648652 Ser GGA T GCCC cctgatcgtt G - C G - C A - T A - T G - C G - C G - C T A T C T C C C A T C G A C | | | | | G G T A C G G A G G G C G + | | | T T C G T G C C T A G TAGGCGGTTACACCGCCTC C - G G - C C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |