Sequence ID | >WENV170648672 |
Genome ID | JRHI01001341 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 17338 |
End posion on genome | 17421 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
atgcgcctgc |
tRNA gene sequence |
GCCGAGCTGGCGGAACGGTAGACGCCGTGGTCTTAAAAACCACTGGGGGCAACCCCGTCC |
Downstream region at tRNA end position |
ttgtcgggta |
Secondary structure (Cloverleaf model) | >WENV170648672 Leu TAA c ACgc ttgtcgggta G - C C - G C - G G - C A - T G - C C - G T G T G G C C C A C A A G | | | | | G G G G C G C C G G G C G | | | T T T A C G C A G C TGGGGGCAACCCCGT G - C T - A G - C G - C T - A C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |