Sequence ID | >WENV170648678 |
Genome ID | JRHI01001359 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 6041 |
End posion on genome | 6127 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tgtacttcgt |
tRNA gene sequence |
GCGGAAGTGGCGGAACTGGCAGACGCGCAGGACTTAGGATCCTGTGGGGTAAAACCCGTG |
Downstream region at tRNA end position |
tagcatcact |
Secondary structure (Cloverleaf model) | >WENV170648678 Leu TAG t ACCA tagcatcact G - C C - G G - C G - C A - T A - T G - C T A T T T T C C A C A A G + | | | | A T G G C G G A A G G C G | | | T T G A C G C C A G G TGGGGTAAAACCCGT C - G A - T G - C G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |