Sequence ID | >WENV170648680 |
Genome ID | JRHI01001371 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 19300 |
End posion on genome | 19387 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
acggctagtt |
tRNA gene sequence |
GGAGAGGTGCCGGAGTGGCCGATCGGGCCGGTCTCGAAAACCGGTGTGGACGCAAGTCTA |
Downstream region at tRNA end position |
tatcggaagt |
Secondary structure (Cloverleaf model) | >WENV170648680 Ser CGA t GCtt tatcggaagt G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G G C C G A G G G C G + | | | T T C T C G G C G A G TGTGGACGCAAGTCTACC C - G C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |