Sequence ID | >WENV170648685 |
Genome ID | JRHI01001406 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 1171 |
End posion on genome | 1079 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gcgcttgacc |
tRNA gene sequence |
GGAGAGATGGCCGAGTGGTCGAAGGCACTCCCCTGCTAAGGGAGCATACGCCCAAAAAGT |
Downstream region at tRNA end position |
gcattgatcc |
Secondary structure (Cloverleaf model) | >WENV170648685 Ser GCT c GCCA gcattgatcc G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A A CATACGCCCAAAAAGTGTATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |