Sequence ID | >WENV170648716 |
Genome ID | JRHI01001598 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 8077 |
End posion on genome | 8169 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gggcccgggT |
tRNA gene sequence |
GGAGAGGTGGCTGAGTGGCCGATAGCGCCGGTTTGCTAAATCGGTGAAGGGATTAAACGC |
Downstream region at tRNA end position |
tcccctgtct |
Secondary structure (Cloverleaf model) | >WENV170648716 Ser GCT T GTtt tcccctgtct G - C G - C A - T G - C A - T G - C G - C T A T C G C C C A T G A G | | | | | G G G T C G G C G G G C G + | | | T T C T A G C C G A G TGAAGGGATTAAACGCCCTTCC C - G C - G G - C G + T T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |