Sequence ID | >WENV170648726 |
Genome ID | JRHI01001666 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 9104 |
End posion on genome | 9015 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aattaaaggc |
tRNA gene sequence |
GGAGGAGTGGGTGAGCGGTTGAAACCGGCGGTCTTGAAAACCGTTAGACCCGAAAGGGTC |
Downstream region at tRNA end position |
tacaatatac |
Secondary structure (Cloverleaf model) | >WENV170648726 Ser TGA c GCCA tacaatatac G - C G - C A - T G - C G - C A - T G - C T A T C T C C C A C G A G | + | | | G G G T G G G G G G G C G | | | T T T A A C C T G A G TAGACCCGAAAGGGTCTC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |