Sequence ID | >WENV170648732 |
Genome ID | JRHI01001705 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 17401 |
End posion on genome | 17315 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tgcctcgcgg |
tRNA gene sequence |
GCCGAGCTGGCGGAACCGGTAGACGCAGCGGTCTTAAAAATCGCAGAGGGAAACCTCATC |
Downstream region at tRNA end position |
ctcaagaccc |
Secondary structure (Cloverleaf model) | >WENV170648732 Leu TAA g ACCA ctcaagaccc G - C C - G C - G G - C A - T G - C C - G T A T G G C T C A C A A G | | | | | G C G G C G C C G A G C G | | | T T G A C G C T A G A AGAGGGAAACCTCAT G - C C - G G - C G + T T - A C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |