Sequence ID | >WENV170648744 |
Genome ID | JRHI01001759 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 13618 |
End posion on genome | 13702 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ggcgaaactt |
tRNA gene sequence |
GCGGAAGTGGTGGAACTGGCAGACACACCATCTTGAGGGGGTGGCGCCGAAAGGCGTGGG |
Downstream region at tRNA end position |
attttgcaga |
Secondary structure (Cloverleaf model) | >WENV170648744 Leu GAG t ACCA attttgcaga G - C C - G G - C G - C A - T A - T G - C T A T C C C C C A C A A G | | | | | A T G G T G G G G G G C G | | | T T G A C A C C A G A CGCCGAAAGGCGT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |