Sequence ID | >WENV170648767 |
Genome ID | JRHI01002127 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 13915 |
End posion on genome | 13830 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tcccaaccaT |
tRNA gene sequence |
GGGCAGGTGGCCGAGTGGTTAATGGCAGCAGACTGTAAATCTGCCGCGCTCCGCGCTACG |
Downstream region at tRNA end position |
tccattacgc |
Secondary structure (Cloverleaf model) | >WENV170648767 Tyr GTA T ATgt tccattacgc G - C G - C G - C C - G A - T G - C G - C T A T C A T C C A T G A G | | | | | G G G C C G G T A G G C G + | | | T T T T G G C T A A A CGCGCTCCGCGCTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |