Sequence ID | >WENV170648775 |
Genome ID | JRHI01002175 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 685 |
End posion on genome | 768 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ggcgccgagc |
tRNA gene sequence |
GCCCGGGTGGCGGAACGGCAGACGCAGGCGGCTTAAACCCGCCGGCCCCTCGGGGCGTGG |
Downstream region at tRNA end position |
tgatctgccc |
Secondary structure (Cloverleaf model) | >WENV170648775 Leu TAA c ACgt tgatctgccc G - C C - G C - G C - G G - C G - C G + T T G T C C T C C A C A A G | | | | | G G G G C G G G A G G C G | | | T T C A C G C A G A GGCCCCTCGGGGCGT G - C G - C C - G G - C G - C C C T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |