Sequence ID | >WENV170648783 |
Genome ID | JRHI01002230 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 11845 |
End posion on genome | 11746 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
gtttgggccc |
tRNA gene sequence |
TGGGGATGTTCGGGGGCTGGTGCCTTCCGCGGTCTTCAAAACCGTTGTGAGGTCCTGATG |
Downstream region at tRNA end position |
ctcctgaact |
Secondary structure (Cloverleaf model) | >WENV170648783 SeC(p) TCA c CCAc ctcctgaact T + G G - C G - C G - C G - C A - T T - A C C G C C T A C T C G G G T | | + | T T G G C T G G G T T A G | + C G G C T T C T G C C TGTGAGGTCCTGATGAGGGGTCTCAGGT G + T C - G G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |