Sequence ID | >WENV170648786 |
Genome ID | JRHI01002254 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 6688 |
End posion on genome | 6599 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tcacagccgc |
tRNA gene sequence |
GGAGAGGTGTCTGAGCGGTTGAAAGAGCTCGCCTCGAAAGCGAGTGTAGGAGAAATCCTA |
Downstream region at tRNA end position |
tattgttttt |
Secondary structure (Cloverleaf model) | >WENV170648786 Ser CGA c GCCA tattgttttt G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A C G A G | | | | | G G G T C T G T G G G C G | | | T T T A A G A T G A G TGTAGGAGAAATCCTACC C - G T - A C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |