Sequence ID | >WENV170648794 |
Genome ID | JRHI01002306 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 8966 |
End posion on genome | 8882 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cctgagccgc |
tRNA gene sequence |
GGGCGTGTGGCGGAACTGGCAGACGCGCTGGATTTAGGTTCCAGTGGGGCGACCCATCAG |
Downstream region at tRNA end position |
tcgccgctgc |
Secondary structure (Cloverleaf model) | >WENV170648794 Leu TAG c ACGA tcgccgctgc G - C G - C G - C C - G G - C T T G - C T G T G T C T C A C A A G | | | | | G T G G C G C A G A G C G | | | T T G A C G C C A G G TGGGGCGACCCAT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |