Sequence ID | >WENV170648805 |
Genome ID | JRHI01002451 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 6836 |
End posion on genome | 6919 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgtttcgcgc |
tRNA gene sequence |
GGGGAAGTGGCGGAACGGTCTACGCGATCGCCTCAAAAGCGATTGAGCTTACGCTCTTGT |
Downstream region at tRNA end position |
gcgcccgcac |
Secondary structure (Cloverleaf model) | >WENV170648805 Leu CAA c ACat gcgcccgcac G + T G - C G - C G - C A - T A - T G - C T A T C A C C C A C A A G | | | | | G G G G C G G T G G G C G | | | T T T A C G C C T G TGAGCTTACGCTCTT A - T T - A C - G G - C C - G C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |