Sequence ID | >WENV170648826 |
Genome ID | JRHI01002713 |
Phylum/Class | [JRHI] sediment metagenome; sediment from deep within a dark volcanic ice cave with no known source of introduced |
Species | |
Start position on genome | 2658 |
End posion on genome | 2576 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atccggccca |
tRNA gene sequence |
GCGCGGATGGCGGAATCGGTAGACGCGCGGGACTTAGGATCCCGTGGGGAGACCCGTCCG |
Downstream region at tRNA end position |
cggcgctcgc |
Secondary structure (Cloverleaf model) | >WENV170648826 Leu TAG a ACgg cggcgctcgc G - C C - G G - C C - G G - C G - C A - T T G T G G C T C A T A A G | | | | | G C G G C G C C G A G C G | | | T T G A C G C T A G G TGGGGAGACCCGT C - G G - C G - C G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |